WWLPT

"Fishing Out Microsatellites"|

Objective

Materials

Procedure

Questions

File for Printing

Teacher Notes

| Background | Objectives | Materials | | Procedure | Questions |
| File Format for Printing |

Background

In the Spring of 2001, Francis Collins, director of the U.S. government’s Human Genome Project, and Craig Venter, founder and president of Celera a private company, jointly reported that the first draft of the human genome had been completed.  As a result of this event a number of interesting facts about our genome became immediately clear.

• We have a number of genes that are quite similar or identical to genes found other living things.
• Our genome is now thought to contain between 30,000 and 50,000 genes when it was previously thought to contain 100,000 genes or more.
• The majority of our DNA is non-coding or ‘junk’ DNA.  In fact, as little as 1-3% of our DNA is composed of the coding regions we call genes.
• The greatest quantity of non-coding DNA comes in the form of ‘microsatellites’.

Microsatellites are patterned non-coding or junk DNA regions containing adjacent or tandem repeating sequences.  For example, the top strand of DNA shown below contains a microsatellite with the repeat sequence CAAT.

CTACAATCAATCAATCAATTCG

GATGTTAGTTAGTTAGTTAAGC

During the analysis of microsatellites in humans and other organisms it has become apparent that the number of repeated sequences in a particular microsatellite locus can vary (location on the chromosome).  In other words, one individual may have a maternal chromosome microsatellite locus that contains three tandem repeats while their paternally derived chromosome may have a microsatellite locus containing five tandem repeats.  Similarly, many microsatellite loci have more than two variation or alleles (polymorphic).

The fact that individuals or organisms have different numbers of repeats has been useful to biologists.  Microsatellite differences are used in the DNA fingerprinting of individuals and has allowed ecologists to gather information on the variation that exists in populations of a species.  

In the following activity, you will first participate in a kinestheticexperience designed to aid your understanding of 1) microsatellites in general, 2) the ‘Slipped-Strand Mispairing’ mechanism hypothesized to create differences in the number of tandem repeats observed microsatellites, and then you will learn how such changes in microsatellites are believed to be important in the evolution of virulence in bacteria through reading the article “Microsatellites: Agents of Evolution”.

1. You should be able to define and graphically represent a microsatellite.
    

2. You should be able to describe and graphically represent the slipped-strand mispairing mechanism involved in producing increases and/or decreases in microsatellite repeats.
    

3. You should be able to describe the importance of microsatellites in producing the variability that allows Neisseria gonorrhoeae and Hemophilus influensae to adapt to a changing host environment.
    

1. Colored Construction Paper (red, green, and blue)
    

2. The Article - E. Richard Moxon & Christopher Wills (1999)  DNA Microsatellites: Agents of Evolution, Scientific American, January. Pages 94-99.
    

1. Acquire a single piece of construction paper labeled having a sequence of three or four nucleotides and complete the following separate Kinesthetic activities as directed by your teacher.  While waiting for the class to get organized, complete question 1 in the “Microsatellite Activity Questions” sheet.
    

2. Kinesthetic Activity One: Create a Parental Strand of DNA and complete DNA replication.  After completing this activity answer question 2.
    

3. Kinesthetic Activity Two: Create a Slip-Strand Mispairing causing an increase the number of Microsatellite Repeats.  After completing this activity answer question 3.
    

4. Kinesthetic Activity Three: Create a Slip-Strand Mispairing causing a decrease in the number of Microsatellite Repeats.  After completing this activity answer question 4.
    

1. For homework, read the the introduction and “Smart Microbes” sections to the article “DNA Microsatellites: Agents of Evolution”, and answer the questions 4 through 10.

Questions

Kinesthetic Activity Questions

1. Circle or highlight the microsatellite shown in the below and then write a short definition for a microsatellites.

CTACAATCAATCAATCAATTCG
GATGTTAGTTAGTTAGTTAAGC
 

2. Create an original labeled diagram for explaining the slipped-strand mispairing mechanisms for increasing the number of repeats in a microsatellite.
    
3. Create another such diagram for explaining the slipped-strand mispairing mechanism for decreasing the number of repeats in microsatellites.

Bacterial Homework Questions

To answer the following questions you will need to read the article “DNA Microsatellites: Agents of Evolution”.

4. Describe the function of the Opas genes found in Neisseria gonorrhoeae.
    

5. What microsatellite repeat is contained within the Opas gene?
    

6. How does the Slipped-Strand mechanism affect the function of the Opas gene?  How often does it occur?
    

7. Explain how and why a deletion of a microsatellite repeat in the Opas gene changes the translated protein?
    

8. Explain how and why an insertion of a microsatellite repeat in the Opas gene changes the translated protein?
    

9. Describe the process of reversible switching and discuss its importance to the level of deadliness or virulence of in bacteria.
    

10. Describe the importance of microsatellites for the life of Hemophilus influenzae.

| Back to Activities |