[WW HOME][BIOLOGY][BIOTECH][SEARCH]


CRACKING THE CODE/CLONING PAPER PLASMID

Patricia Colbert and Phillis Unbehagen
1993 Woodrow Wilson Biology Institute


INTRODUCTION

"CRACKING THE CODE"/"Cloning Paper Plasmid" activities can (1) serve as a review of the "genetic code" and the role it plays in our life; and, (2) to help students see how genes may be manipulated for genetic research, namely, gene cloning/genetic engineering.

The laboratory time, the specialized equipment and expertise to carry out recombinant DNA experiments may be lacking in the high school. Activity 2 will help students conceptualize the mechanics involved in cutting and ligating DNAs into a plasmid vector with "sticky ends" of complementary DNA base pairs.


BACKGROUND INFORMATION:

In Activity One the student will decode the DNA molecule, read, and then write a message. Students are often taught about the DNA molecule but never really understand just how important this molecule is in their lives. With the simple activities presented here, the students will learn that the bases of the DNA molecule is very much like the alphabet. The letters, in the alphabet, when written in a certain sequence, form a word, likewise, the nucleic acids, when written in a certain sequence will code for the assembling of a specific protein. If the code is incorrectly written than the result is a genetic mistake (mutation). Thus by using paper models to view these concepts students will get a better understanding about the genetic code and why genetic engineering may eventually be used to correct these errors, treat these errors, or even prevent an illness if discovered early enough.

In Activity Two, the student will clone the DNA molecule to make a vaccine. Four steps are required to carry out "DNA cloning".

  1. DNA isolation Technically DNA can be isolated from any organism with DNA.

  2. Restriction endonuclease digestion "Restriction enzymes" recognize and cut at specific sequences of DNA base pairs creating DNA fragments. These "restriction enzymes" revolutionized molecular biology by allowing DNAs to be cut at known sites with discrete DNA ends. There are more than 180 commercially available restriction enzymes for cutting DNA at specific sites.

  3. DNA ligation DNA ligase is an enzyme that recombines DNA fragments created with restriction enzymes by forming phosphodiester bonds between two DNA molecules, joining them into a single molecule - thus, "recombination".

  4. Cell transformation The vector DNA (plasmid) containing the "new" genes must now be inserted into host cells. The cells are made porous to DNA by a number of techniques and become transformed as they take up the recombinant DNA molecule. A group of genetically identical cells, all containing the same recombinant DNA molecule are called clones. The unique gene recombination now may be replicated and expressed by these cells.

    The students will simulate recombinant DNA techniques and make a polyvalent vaccine paper model. The term polyvalent refers to the ability of a single virus to impart immunity to another, unrelated virus. Immunity is developed against foreign antigens which are molecules that are not recognized as "self". For viruses, antigens are often the protein coat. If the gene for the major antigen of one virus is spliced or cloned into a second nonvirulent virus and that antigen is expressed (the protein is made) then this recombinant virus will immunize a host against both. To date several antigens have already been inserted into Vaccinia and proved effective in producing antibodies and immunity in animals. (See references.)

    The Vaccinia virus (a weakened poxvirus similar to the smallpox virus) has been used to virtually eradicate smallpox from the world. In the early 1980's, it was suggested that a recombinant Vaccinia virus joined with gene coding for an antigen from another disease organism would have many advantages as a live vaccine with the ability to replicate.

TARGET AGE/ABILITY GROUP:

Grades 10 - 12 basic, regular, advanced biology classes

STUDENT/CLASS TIME REQUIRED:

1 - 2 class periods depending on ability of class


TEACHER GUIDE FOR PREPARATION OF MATERIALS:

15 - 30 minutes

Activity 1:

Print instructions and model with blank spaces.

Activity 2:

click on image to enlarge




TEACHER'S OUTLINE FOR PRESENTATION OF ACTIVITY

  1. Activity One may be used to review the basics of the DNA code. (Activity Two may be used to introduce or to summarize wet labs involving plasmid isolation, restriction endonucleases and recombinant techniques.)

  2. Introduce the basic four steps required to carry out DNA cloning with the appropriate terms (see introduction above).

  3. Set the scene: "You are a genetic engineer who will be constructing a polyvalent, recombinant vaccine to immunize humans against the hepatitis B virus and smallpox virus."

  4. Divide the class into small groups to brainstorm about this problem. Have each group list and discuss terms such as immunity, antigen-antibody reaction, vaccination, virus. Have groups orally share ideas generated.

  5. Put on overhead the restriction enzymes and review DNA sequence and base pair bonding. Model how restriction enzymes work.

  6. Pass out materials. Do paper cloning activity.

  7. Have students/student groups compare recombinant paper model.

  8. Ask the question;"What must be done after DNAs are isolated, digested, and ligated into plasmid in order for this unique recombinant DNA molecule to be useful?" Have students describe the "rest of the story". How they would model cell transformation and gene expression.

  9. Have students write a proposal to NIH giving three reasons with supporting statements why they should be funded to develop this recombinant vaccine.


REFERENCES

Blatt,R. (1993); Brock (1992); Mulcahy (1989); Old (1989); Panicali (1982); Smith (1983).


"CRACKING THE CODE"

To serve as a review of the "genetic code".

This activity is based on material developed by Larry McGowan, Grandteacher, Marlborough Public Schools.

PURPOSE:

To increase your understanding of the decoding of the DNA molecule. To fully understand the concept of "triplet codon"

MATERIALS:

DNA molecule with a version for reading and a version for writing
  • Master code
  • Model with blank spaces
  • PROCEDURE:

    1. You are given a brief message written in the geneticcode. You are to divide the message into triplets (codon). Then using the version for reading, enter the letter signified by each codon.

    2. You are to compare the codons to the master code to spell out the letters in the message so that you can read it.

    3. What is the message?

    4. You will then use the master code to write a message to someone in this class, using the genetic code.

    A Version For Reading A Version For Writing

    AAA=A       GGG=C              A=AAA     R=ACC
    AAC=E       GGA=H              B=CCC     S=GAA
    AAG=G       GAG=N              C=GGG     T=AGG
    AAT=I       GAA= S             D=TTT     U=TAA
    ACA=K       GAC=Y              E=AAC     V=ATT
    AGA=M       GCA=Z              F=CCA     W=ACG
    ATA=0       GGC="              G=AAG     X=CGA
    ACC=R       GCT=initiator      H=GGA     Y=GAC
    AGG=T       TTT=D              I=AAT     Z=GCA
    ATT=V       TTA=J              J=TTA     ,=TTC
    ACG=W       TAT=P              K=ACA     .=TTG
    CCC=B       TAA=U              L=CAC     "=GGC
    CCA=F       TTC=,              M=AGA     space=CTG
    CAC=L       TTG=.              N=GAG     initiator=GCT
    CAA=Q       TGC=terminator     0=ATA     terminator=TGC
    CGA=X                   P=TAT     
    CTG=space               Q=CAA     
    


    ACTIVITY TWO: Cloning Paper Plasmid

    This activity is based on protocol of Dr. Henry Mulcahy, Suffolk University.

    PURPOSE:

    To apply your knowledge of the "genetic code" in the making of a RECOMBINANT vaccine against smallpox and hepatitis B

  • To visually demonstrate recombination of DNA in the making of vaccines
  • To understand how genes can be inserted into another DNA - "recombine"
  • To conceptualize "restriction enzymes" and recognition of specific sites
  • MATERIALS:

  • DNAs to be combined: carry other DNAs. This DNA will allow the recombinant DNA molecule (that you will make) to be duplicated in the bacterial host, Escherichia coli.

  • VACCINIA VIRUS containing genes which code for surface proteins. These proteins will act as antigens against which antibodies can be formed by the person immunized. (Smallpox virus is so closely related to Vaccinia that Vaccinia virus is what is given in the traditional smallpox vaccination.) This DNA must be kept intact so it can serve as a vector in a mammalian host.

  • HEPATITIS B VIRUS containing the gene for the major surface antigen(HBsAg). By inserting this gene into the vaccinia virus DNA, mmunity may be elicited for both smallpox and hepatitis.

  • DNA LIGASE the enzyme which joins or "ligates" pieces of DNA together (use Scotch tape).

  • RESTRICTION ENDONUCLEASES to cut DNA at specific sites to make the pieces we need. Use scissors to "NICK" double stranded DNA on both strands. After being nicked, the strands are held together only by weak hydrogen bonds between complementary A-T and G-C pairs, fall apart and the DNA is broken. These enzymes are found in nature and used by bacteria to cut up and destroy "foreign" DNA. The unique ability to cut DNA only at specific nucleotide sequences have made these enzymes the cornerstone of the field of genetic engineering.
  • RESTRICTION ENDONUCLEASES: DNA SITES AT WHICH "NICKS" ARE MADE

    BamHI     G0GATC C     FOR     ...G          GATCC...
         C CTAG=/G          ...CCTAG          G...
    
    SstI     G AGCT0C          ...GAGCT          C...
         C=/TCGA G          ...C          TCGAG...
    
    HindIII     A0AGCT T          ...A          AGCTT...
         T TCGA=/A          ...TTCGA          A...
    
    EcoRI     G0AATT C          ...G          AATTC...
         C TTAA=/G          ...CTTAA          G...
    

    In this exercise, you are given three strips of paper representing a plasmid DNA (pBR322), a gene from Vaccinia and a gene from Hepatitis.

    PROCEDURE

    1. Isolate (cut out) the pBR322 DNA and circularize it into a small plasmid by using tape to connect the free ends. Be sure to make"staggered" cuts to preserve the "sticky ends". Plasmids are circular, double-stranded extra chromosomal DNA molecules that contain specialized genes and have the ability to be replicated in the bacterial cell.



    2. Isolate (cut out) the Vaccinia DNA fragment. Examine the DNA sequence for restriction enzymes that can be used to cut the vector pBR322.

    3. Identify the restriction endonuclease used to generate the Vaccinia virus DNA fragment. Cut the vector, pBR322 with the same enzyme. BE SURE TO PAY ATTENTION TO WHERE THE ENZYME ACTUALLY NICKS THE STRANDS OF DNA TO GENERATE STICKY ENDS. Make sure the "sticky ends" of the two DNAs are complementary A-T, C-G.

    4. Ligate (scotch tape) the Vaccinia DNA and the Plasmid pBr322 vector. You NOW have a recombinant DNA plasmid that codes for the surface proteins of the virus.

    5. Isolate (cut out) the Hepatitis B DNA fragment. You will now insert the hepatitis B DNA into Vaccinia virus DNA segment of your first recombinant DNA molecule.

    6. Identify a restriction enzyme that can be used to cut out the HBsAg gene and insert it into your recombinant DNA molecule (step 4). REMEMBER: IF THERE ARE TWO SITES ON A DNA MOLECULE RECOGNIZED BY A SPECIFIC RESTRICTION ENZYME, IT WILL CUT BOTH.

    7. Ligate (Scotch tape) the hepatitis B DNA fragment to the Vaccinia virus DNA. You NOW have a large circular molecule with DNA from three different sources. COMPARE your paper model with other students'. Discuss any differences.

    8. How can this recombinant DNA molecule be used to generate a recombinant vaccine? What is the next step necessary in order for this new gene combination to be expressed?


    PINK:  pBR322 DNA with "Sticky Ends"
    
              AmpR
         Hind III
    EcoRI
    
    CCGAAGCTTCACGTAGCGCTAGGGCTAGGTAGCTTGCCATGGATTGAATTCGTGTACT
    GCTTTACGGCTAAA
    TTTGGCT
    TCGAAGTGCATCGCGATCCCGATCCATCGAACGGTACCTAACTTAAGCACATGATCGAA
    ATGCCGA
    
    "sticky ends"
    "sticky ends"                                                                                                                             
    
    PBR 322 DNA with "STICKY ENDS"
    Use the "sticky ends " and scotch tape "LIGASE' to make this PLASMID into a piece of CLOSED
    CIRCULAR  DNA.  The region encoding AMPR  is marked by double lines.
    


    YELLOW:  Vaccinia DNA Fragment
    
    HindIII      SstI      Bam HI     Hind III
    AGCTTATCGATCGGATTCGATCTAACGAGCTCATTTAGGCAGTCGAGTCCAATCGATG
    GGATCCTACCGTA
    ATAGCTAGCCTAAGCTAGATTGCTCGAGTAAATCCGTCAGCTCAGGTTAGCTACGCCT
    GGATGGCATTCGA
    
    This represents a fragment of Vaccinia virus DNA which has been previously
    cut on each end with one of the restriction endonucleases with which you have
    been "supplied". Thc Vaccinia surface protein region is marked by double lines.
    


    GREEN: Hepatitis B Virus DNA Fragment
    
         Bam  HI     SstI       HBsAg     Bam HI
    GATCCAGTTGAGCTCTATGGCGATGACTACCAGTCTCAGAG
    GTCAACTCGAGATACCGCTACTGATGGTCAGAGTCTCCTAG
    
    This represents a fragment of the hepatitis B virus DNA containing the gene
    for tbe major surface antigen (HBsAg). This DNA has been previously cut with one
    of the restriction endonucleases with which you have been "supplied."  The HBsAg
    gene region is marked by double lines.
    

    [WW HOME][BIOLOGY][BIOTECH][SEARCH]


    The Woodrow Wilson National Fellowship Foundation * webmaster@woodrow.org
    CN 5281, Princeton NJ 08543-5281 * Tel:(609)452-7007 * Fax:(609)452-0066